Paymon Ebrahimzadeh :: Projects

   
  Back

Design By Sequence

     

Title: Nature and Creation

Medium and Dimensions: I created music that has two movements: The first is called “Nature” and is an original composition, and the second is called “Creation” and is a compilation of six different pieces. Along with the CD containing a recording of the two pieces, there is an 8.5” by 11” printed score.

G: g min triad
A: Bb Maj triad
C: c min triad
T: D Maj triad

     
 
     
     

Statement:

While researching molecular music, I came to discover that molecular music was the apex of the postmodern movement: it was an art that had no artistic value itself, but stood only to represent a greater idea. Unlike other postmodern art, molecular music does care to evoke passion, but rather stand as a means to experience our DNA on a new level. Instead of traditional molecular music, I wanted to incorporate passion into the music as a means to impress upon the listener certain ideals and provoke the audience to think about questions essential to our changing society in relation to biotechnology – much like the aims of other postmodern art.

After receiving my DNA strand, through research I came to understand that it was a gene found in nitrogen fixation. This gene itself points to the heart of the biotechnology debate: although we seem to control everything around us, in fact we are tied to the very essentials that created us, and always will be. This is such a departure from the common notion that humans dominate the world and therefore should be able to manipulate it, that I decided to make this the central concept in my piece.

The first movement called “Nature” was an original composition which attempts to show the harmony that can and once existed between nature (represented by the DNA chords) and society (represented as my original composition). As can be heard, the ‘society’ works and in facts coexists with nature, represented by the chords harmoniously existing with the music being played.

The second movement entitled “creation” is an attempt to aurally demonstrate biotechnology and the resulting society if our attempts at controlling genes go too far. Listeners should hear common themes twisted, juxtaposed and modulated – much like the genes themselves. The result is a disturbing mix of different styles of pieces, incoherently existing within one melodic idea. These themes are analogous to DNA of different organisms – much like the music is from different styles and different eras. Throughout the piece, the DNA chords increase in volume, seemingly fighting the progressing ‘society’. As times passes, the nature begins to fight society as society has strayed too far from nature. As a result, both society and nature are in disarray. As the piece climaxes, it reaches a supposed death with the theme from Beethoven’s 5th Symphony. Ironically, the final phrase is a look into a perhaps better future, were both exist together – an inherent reference to the first movement and to the beginning of the second movement.

On another level higher level, the idea of creation comes into play. By playing music over chords from DNA, from “Nature” I am attempting to show that these aspects are one and the same – that our notion of music is derived from nature, as it has existed in nature from the beginning of time – through DNA. “Creation” itself is an attempt to show our society as music played over nature, and the subsequent result when society forgets that nature is a force as well – much like we have forgotten the need for nature in order to get our needed amounts of nitrogen (through the DNA which is playing). By incor-porating the idea of “Nature and Creation”, I encourage the listener to question our role in society, and also question the role of biotechnology as “Creator” or perhaps just another force of “Nature”.

Materials: I worked with the program Finale 2003 to compose the music.
The six other pieces came from selections from:

“The Entertainer” Scott Joplin
“Humoreske” A. Dvorak
“Turkish March” L.v.Beethoven
“Arabesque” C. Debussy
Piano Sonata op.27 no. 2 “Moonlight” L.v.Beethoven
The Fifth Symphony L.v.Beethoven

 

Original Sequence:

AGAAAGATCATGGGCGGGGGTGACTGGAAGA
GTAGGTAACATCAAACTCCAGCCAGACGATTC
CGGTCTGCTCAGCCAGGCCCCGCACAAACCGA
GCCAAA

BLAST: Nitrile hydratase alpha chain
Total: 102 Bases in length

 

Mutated Sequence:

AGAAACTAGATGGGGGGGGGTGGTCAGAAGAGT
AGGTAACAACTGGTAACAACTACTCCAGCCAGA
TAGCTCCGGTCTGCTCAGCCAGGACCGACTCGGG
CCCCCCACAGACCGACCGAAA

Total: 122 Bases in Length

     

Genetic Art Proposal

 

   
Title:     
     
Summary: