Ji Yoon :: Projects

   
  Back

Design By Sequence

     

Title: Inhibition
Medium and Dimensions: metal chain, duct tape, stones, and blocks of Styrofoam and foam. paint, wood.

Perfect Chain (Metal Chain)
C: Red
T: Gray
A: Yellow
G: Dark Green

Mutated Chain
C: 18 Smooth (Rock)
T: 29 Sticky (Tape)
A: 28 Soft (Foam)
G: 25 Rough (Styrofoam)

     
 
     
     

Statement:

This artwork, titled Inhibition, presents a flawless, 100-base DNA string in the form of a metal chain. This metal chain is wrapped around a severely mutated version of the same DNA string, which has been put together in the form of a tall bridge. This structure of mutated DNA consists of duct tape, stones, and blocks of Styrofoam and foam, which are materials that are known for their distinct tactile properties.

The internal bridge structure represents a DNA string mutated through numerous cases of inversion and translocation. Its number of bases is the same from the original string. This structure is made of materials that possess soft, rough, smooth, and sticky textures, which represent the four different bases. This structure symbolizes the true nature of DNA, in that it certainly isn’t immutable, and that it does not directly engender everything that makes us human. Certain human properties, including the sense of touch, are the expression of genes in particular contexts. This means that the true strength behind such human phenomena lies within the expression of genes in certain conditions, rather than simply the genes themselves.

The metal chain, which represents the flawless DNA string, shows the popular misplacement of concern on only the genes themselves. Many people in society resign themselves to a sort of genetic determinism, in that their genes will map out their entire development, physical properties, and fate. This is untrue in that people can decide to place themselves in different situations that will require the expression of different genes. The metal chain is wrapped around the bridge structure to show the popular misconception towards genes overshadowing its true nature.

Although this project turned out to be much difficult than originally anticipated, it was oddly pleasurable to work on it. It feels good to have constructed something that expresses complex ideas out of rather unrelated items, and I hope that it can communicate its message with the viewers as well.

 

Original Sequence:

MCDBS03_04_Samp_07_700 6Fe-6S prismane cluster protein
CTCGGATCCACTAGTAACgaAaGC
CAGTGTGCTGGAATTCGCCCTTTGGA
CTTAAATAGTCCTATTAAAATGCTCAG
GGAGGGATGAgAATGTTTTGTTA

 

Mutated Sequence:

TGATTAGTCACTATCAATATTCG
TGTGTGTAAGATTGATGCGTGTGTCT
GCAGCTGTAAGAGTAAATCGACGA
CTATCGCAGCTGCAAGCTACGCTAAGA

 
     
     
     

Genetic Art Proposal

 

   
Title:     
     
Summary: