Sirin Petch :: Projects

   
  Back

Design By Sequence

     

Title: Hats off to DNA
Medium and Dimensions:

Normal hat: 10_ x 9_ in.
Mutated hat:10 x 10 in.
Materials: Wintuk yarn (black, dark blue, blue, light blue, red, green, yellow, violet), I/9 crochet needle

     

Normal Sequence:

C = black
G = dark blue
A = blue
T = light blue

 

Mutated Sequence

C = red
G = green
A = purple
T = yellow

     
 
     
 
     
 
     
 
   
     

Statement:

Picture yourself in a time where genetic screening is as common as a blood test, and the resulting profile dictates to everyone at a glance the kind of person you are. Information about your health status, physical traits, and how smart you can become, would not be a mystery to anyone. It’s almost like making an unintelligent remark when you first meet someone, and giving a first impression of stupidity; your genetic makeup could change the way people behave towards you before they got to know you or your full capabilities. Also, if this happened often enough, it might even induce a self-fulfilling prophecy effect.

Your clothing can supposedly reveal a lot about your personality. As a result, people often form expectations based on how you look before they even meet you. From the DNA sequence I was given, I crocheted two hats; articles of clothing that I believe are usually noticed before anything else when they are worn. For the first hat, I used black yarn to represent the nitrogenous base cytosine, dark blue to represent guanine, regular blue for adenine, and light blue for thymine. There isn’t much significance behind these colors, except that blue is easy on the eyes and doesn’t call for much attention. These ordinary colors look pleasing together, and give a sense of simplicity and normality. They were used in order to contrast the bright eye-catching colors of yarn used to make the hat that represents the mutated sequence. The first 40 base pairs of the sequence I was given were used to determine the sequence of colors in the hat, starting with the rim and finishing at the top where the ends tie off. Using a half stitch, double loop method of crochet, I let each row stand for one base pair, and knitted that row using the color that stood for the particular base pair. For instance, since the first four base pairs were C, G, C, and C in that order, the first four rows of the non-mutated hat would be black, dark blue, black, and black.

In the mutated version of the hat, I used red yarn to stand for C, green yarn for G, purple yarn for A, and yellow for T. There are more representations in this color selection than before. For instance, complimentary colors were used for C with G and A with T, since this is the way the base pairs bond. In a color wheel, green is across from red and yellow is across from violet. I decided on deletion for the kind of mutation to express. I deleted five base pairs so the total number of rows in this hat is less than the other one. There are thirty-five rows instead of forty. Also, the five deleted bases were located relatively close to each other. The result appeared as a broad purple stripe running across the middle of the mutated hat.

If everyone had to wear their DNA sequence out in the open on their heads, imagine the experiences of someone who bore an abnormal violet stripe across their forehead for the rest of the world to see. Mutations like this would be easy to recognize since people with normal sequences would be very familiar with what it should look like. Someone with a “weird” sequence might have to endure prejudices against their less-fortunate gene sequences. The colors of the mutated hat are also hard to miss. No one would think twice about a person wearing an ordinary blue and black hat, but a handful would stop to look at a red, green, yellow, and purple striped hat.

Overall, I liked the way this project turned out. If there was one thing I could go back and change, I might have selected a more meaningful number of base pairs to use. Instead of forty rows (picked only because it was easy to count and keep track of base pairs by fives) I might have picked a number divisible by three, since every three base pairs in the sequence completes a codon. The hat was stitched inside-out because the texture of each row seemed more DNA-like this way. Each row has a center ridge and the stitches surrounding each ridge “bond” well with the rows above and below it.

Finally, the tassels added to each corner of the hat were made by braiding all four colors of yarn. The harmony of colors created by this braid is spawned from a random intertwining of the four bases used to build the entire hat. It is just like the genetic makeup of an individual. Each time the strands are braided, the colorful outcome is different. Each time a couple has children, (unless they are twins) the children will come out slightly different and unique.

Every stitch holds a part of the hat together, the same way every A, C, T and G says something meaningful in the genomic sequence. The braided tassels tie underneath the chin, and pull together the entire hat. It is the final touch in unifying all the strings as a functioning entity.

 

Original Sequence:

MCDBS03_04_Samp_02_700 => perchlorate reductase

CGCCAAGCTATTTAGGTGACACTATAGAATACTCAAGCTA

 

Mutated Sequence:

Deletion (italicized letters taken out) -
CGCCAAGCTATTTAGGTGACACTATAGAATACTCAAGCTA
=> CGCCAAGCTATTTAGGTGAAAAAATACTCAAGCTA

Broad violet band as seen in mutated hat

 
     
     
     

Genetic Art Proposal

 

   
Title:     
     
Summary: