Tiffany Low :: Projects

   
  Back

Design By Sequence

Title: The Tree of Life
Medium and Dimensions: Paper, inkjet print, duct tape, 47.5’’ x 29’’

Legend: (A) green/$20, (C) yellow/$10, (T) pink/$5, (G) white/$1

     
 
     
     

Statement:

Since its exposure in 1953, DNA and its applications have continued to surprise researches and the public alike. The end of world hunger, longer life spans, and a disease-free society are promises that have kept genetics at the forefront of science. However, competition and financial greed have hindered biotechnology’s progress while stirring up doubt over its benefits. Often, researchers “race” to be innovators in the field, with dreams of prestige, fame or wealth replacing the desire to help society.

This project seeks to represent both the lost purpose of biotechnology, as well as current, “mutated” objectives. The background of the circular portion of my tree consists of the normal sequence, a simple, single-stranded pattern put together from the backsides of Monopoly money. Being the background, this is representative of DNA being the foundation of our bodies and biotechnology. Also, the original sequence is behind the mutated sequence, just as the original idea to better civilization has taken a backseat to corporate greed.

The mutated version was created using Monopoly money to illustrate a duplication mutation of the original sequence. It is the “evil” version of the original sequence in that it represents the corruption associated with many involved with genetics and biotechnology today. Similar to the old saying that money does not grow on trees, DNA is also not a matter to be taken for granted. The wonder and intricacies of DNA have been lost by current and past misuse of it.

While it is true that DNA is available in relatively massive amounts, it should not be used to further an individual’s or a corporation’s bank account.

The base or trunk of the tree lists examples of corruption mentioned in lecture of the Biotechnology and Society class. Specifically these include the death of Jesse Gelsinger, the many deaths occurring from Rezulin, the mislabeling of genetically modified foods, and the scams associated with genetic testing for breast cancer.

The tree is composed mainly of Monopoly money arranged on poster board. Poster board and inkjet print comprise the tree’s base, with duct tape to link the various words together. Mainly the project required copious amounts of gluing and cutting. Previously, I had never created much artwork, and it was an especially new experience for me to combine science and art together. Initially, it was difficult to think creatively because I felt like I was supposed to be thinking logically or scientifically. But once I realized that science as art wasn’t strictly confined to chemistry textbook covers, I was able to create my artwork.

 

Original Sequence:

(Cluster3_Samp_06_700 anaerobic ribonucleoside triphosphate reductase): ACGCCAAGCTATTTAGGTGACACTATACAATACTCAAGCTATG
CATCAGCTTGGTACCGAGCTCGGTCCACTAGTAACGGSCGCCA
GTGTGCTGGAATTCGCCCTTTG

 

Mutated Sequence:

AGGTGACACTATAGAGGTGACACTATAGAAGGTGACACTATAGA
GGTGACACTATAGAGGTGAC

 
     
     
     

Genetic Art Proposal

 

   
Title:     
     
Summary: