Miranda Goodman-Wilson :: Projects

   
  Back

Design By Sequence

     

Title:"DNA in Bloom"

Medium and Dimensions:

Nylon flowers, Gerber Daises, Dental floss, Ribbon
Dimensions: 10x11 inch (fake), 8x9 inch (real)
Legend: T=Red flower, G=Cream flower, C=Pink flower, A=Yellow flower

     
 
     
     
 
     
     
     

Statement:

It seems the more we learn about DNA, the more we forget about the other building blocks of life. Genes, increasingly, are being seen as the sole determining factor in who and what we are, as the nature vs. nurture question becomes increasingly one-sided. As a burgeoning psychologist who believes our genetic material will only ever be part of the story, I wanted to explore the interplay of nature and nurture in my artwork. I contemplated what medium would best express the potential of both DNA and environment in shaping an individual and found inspiration in the classic “tomato thought experiment” which I had been taught in both my biology and psychology classes. The experiment requires that you imagine a gardener grabbing two handfuls of seeds from one bag. One handful is spread in a field well-nurtured, given plenty of water and fertilizer. The other is placed in a field, and then ignored--its environment could definitely be considered impoverished. The experiment predicts that while both field’s plants will show variation within their own population (based on genetic causes), there will be greater variation when comparing the two fields, because of the difference in environment. Different living conditions will lead to different physiologies, regardless of genetic similarity.

This famous experiment inspired me to use plants in my piece, and because this is art I decided to use the most aesthetically pleasing plants available, namely flowers. However this began presenting a logistical difficulty. We were required to use one hundred base pairs, but using one hundred live flowers seemed difficult. As I was thinking of how to circumvent the problem of using real flowers I began thinking about another troubling perception about DNA. There is the assumption that unmutated DNA is both free from error, and the status quo. Diseases are blamed on mutations, allowing the diseased to be seen as somehow inferior. In actuality, everyone’s DNA is mutated, and most mutations are harmless (and occasionally even beneficial). I wanted to explore the misperceptions of mutation, and so I decided that for my “normal” (unmutated) DNA I would use fake flowers. They would be flawless and homogenous, but also artificial. They would be immortal, as many people feel the human species can someday be with the aid of DNA technology. For my mutated sequence I would use real flowers, which would have flaws and variation but also a beauty which vastly surpassed that of the fake flowers.

 

Original Sequence:

TGATTACGCCAAGCTATTTAGGTGACACTATAGAATACTC

 
BLAST Results:
>MCDBS03_01_Samp_13_700 tryptophan synthase beta chain
>MCDBS03_01_Samp_13_700
TGATTACGCCAAGCTATTTAGGTGACACTATAGAATACTCAAGCTATGCATCAAGCTTGG
TACCGaGCTCGGRTCCACTAGTAACGGcCGCCAGTGTGCTGGAATTCGCCCTTTGCCGGC
CGCCTGCAGGAMCTGGCGCCGCGTCTCTTGGCCGATTACGGACTGGAAGTCGCGCACCAT
CATGGGGTAGGGGTGAGGGcCGGCCACCGAGCCGATGAGGTAGTAGGTGGTGCGGACGTT
GGTCACCCAGTCCCTTATGGCCTCGTTCATAGCGTCCTTGAGGGTACCGCTGCCTGCgGC
GAcGGGCACAACTTCGGCACCCAGAAGCTTCATGCGTATCACGTTCAACCGCTGGCGCTC
GGgaARWaCCCGCAGATGACGGGScgGAAcTTTCCCSAgWtTTC
 

Mutated Sequence:

GTATTACGCCAGCTATTTAGGTAGC

 
     
     
     

Genetic Art Proposal

 

   
Title:     
     
Summary: