Michael Bandli :: Projects

   
   
  Back
 

Design By Sequence

     
Title:The Poetry Of Foundations
Medium and Dimensions: Large Piece: 13”H x 3’1”W , Smaller Pieces: 12”H x 11” W
     
 
     
     
 
     
     
     
     

Statement:

In approaching a critique of genes through art, I chose to express my dissatisfaction with the popular notion that our genes determine everything about us; nuances of humour, propensity to anger, and susceptibility to disease are thought by many to be directly related to the billions of strands of coded genetic information that we posses. I however believe that this is untrue: two people, twins or clones for example, with the same set of genes can emerge as completely different people, unique as dictated by their interaction with the world about them.

Language is a perfect metaphor though which to express this idea. Though speech is bound by rules and structures, individual and regional patterns of speech can differ greatly, and the interactions of these speakers mutate the language through exchange of slang. Languages are constantly evolving, and it is of interest to note that the same mutations in language that occur as a result of this evolution are frowned upon by those who chose to reject them in favour of the established ‘pure’ language form, just as many believe that mutations, however numerous or benign, are somehow harmful and to be avoided or corrected.

I decided to use the structure of my Ammonifex Degensii fragment to determine the structure of the poems written here: a CG pair results in a verb, etc. The grammar of the poems is determined by the order in which the bases fall, following the simple legend shown above. I used 50 bases for the first line of the ‘original sequence’ poem; the second line corresponds to the matching base pairs, resulting in a poem of two lines, 25 words each, that I chose to display in a double helix, reminiscent of the DNA which determines their structure. The fragments below follow the same pattern using 16 bases instead of 50 (for sake of space), resulting in two fragment poems of 16 words each. One poem is a clone of the original sequence, using the first 16 base pairs; the second is a mutated fragment comprised of translocated codons chosen at random.

I chose not to mark any of the poems to point out several distinctions. The first is that none of the poems is truly confined to its genetic code: though the structure of each is pre-determined, the words are chosen at random by whim of the artist, just as the expression of personality and experience in each individual is a result of chance encounters and events entirely unrelated to genes. Secondly, the ‘clone’ poem, though an exact fragment of the original, is a wholly different piece, almost completely distinguishable from the original. So many people fear that armies of clones might arise as perfect copies of an individual, or some hope that the unduly deceased can be somehow resurrected through cloning, when in fact, the clone would most likely be nothing like its host. Lastly, the ‘mutated’ poem is also indistinguishable from the natural variation in the others, reflecting the fact that most mutations are not in fact the cause of malfunctioning genes, but are simple errors in code that give rise to evolution and diversity: if every genome were to match exactly, how would physical characteristics differ significantly enough to allow natural selection to occur? Mutations are rarely the enemy, instead, they are simply nature’s way of helping species to cope with their environments.

An observer of all three, without prior knowledge of their codes, would be hard pressed to pick out each for what it is, just as in populations, each individual is a mutation from the next, or could be a twin to another, and yet it is rare that one can detect any sign of such state. This forces observers of the piece to examine their own perceptions of the importance of the genome in determining self.

 

Original Sequence:

ACGGTACCGGTTACACAGAATTTCCGGCAGCAATTTGCCGCTGCCAATG

 

Mutated Sequence:

AATGTACCGAATTACA

 
     
     
     

Genetic Art Proposal

 

   
Title:     
     
Summary: